SGN Marker SSR66

SGN-M739

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40 High: 50
Repeat motif: ATA   Repeat number: 8
Repeat motif:    Repeat number:
Forward primer: TGCAACAACTGGATAGGTCG
Reverse primer: TGGATGAAACGGATGTTGAA
Predicted size: 185
Derivations 
This marker was derived from EST read SGN-E51285
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43818)
Chromosome
2
Position
17.50 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44836
Forward primer (5'-3')
TGCAACAACTGGATAGGTCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGATGAAACGGATGTTGAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43278)
Chromosome
2
Position
35.50 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44650
Forward primer (5'-3')
TGCAACAACTGGATAGGTCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGATGAAACGGATGTTGAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40771)
Chromosome
2
Position
31.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39289)
Chromosome
2
Position
25.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14085
Forward primer (5'-3')
TGCAACAACTGGATAGGTCG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGGATGAAACGGATGTTGAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 185
Solanum pimpinellifolium LA1589: 183+185
Approximate temperature
50°C
  
PCR data   Exp. ID 24
Forward primer (5'-3')
TGCAACAACTGGATAGGTCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGATGAAACGGATGTTGAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 185+185
Solanum pennellii LA716: 174+185
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR66 was used as an overgo probe on plate 10 [well H2]

Plausible BAC Matches:   P271B17,   P057P09,   P209K17,   P334C12,   P231M17,   P254N12,   P208B13,   P043E10,   P217I07,   P265K20,   P134B18,   P224K10,   P274C23,   P013D05

 Non-Plausible BAC matches

P263L10,   P025A22,   P202H17,   P143F24,   P254N13

 Overgo Sequences

A sequence
TCATTGCGTTGGCTGTCGTCAATC
B sequence
TGTGTGACAACCACTCGATTGACG
AB sequence
TCATTGCGTTGGCTGTCGTCAATCGAGTGG
Marker sequence
GCACGAGGAGGAATGAAGCCGGACCACTCCTCTGTGATATCTGCGACCAC
TCTATAGAAAAACAGAGTGGTTGGATATATTATAACTATGGCCATAATTT
TCTTTCGCATTTCGGGTGTGTTGCTGATATTGTATATGAGAAAGGCGGAG
ATGATAAAGATTATATCATCGGTGTTAAAAGGGGACTGATTAATGTCGAT
GGAGACGATACTTCTATAGTAAACTATCGAGATAACGACGAAGGAATTGT
GAAACATAAGAGATTTTTTCATCGACATGTTCTGCAACAACTGGATAGGT
CGATGGATAATAATAATAATAATAATAATAGTGTGAAGAATCGAAAATGT
GGTATTTGTGGTATGGATATAAGTTCAGATAAGAAAAAAGGATGTTCGAG
TTGTGATTTCATTATTCATGAGAGGTGTTCTTTTTTGCCTGAGAAAATTC
AACATCCGTTTCATCCACATCCACTATCACTCGTTCCTAAAAAAGACGGA
GTTGAAGTTCATTGCGTTGGCTGTCGTCAATCGAGTGGTTGTCACACAAA
TTACACAGTTTTATACCGATGCAAAATTTGTGAATTTCAACTTCATCCGT
CATGTGCTGCAAGTCCAAGGAGATTGAAGAAGCTTGATTTAACTTTGTGC
TACTCATTTCCTTATAAGAATGAA
Genomic location of SSR66  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D739 marker 739
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)