SGN Marker C2_At2g34620

SGN-M7397
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple308728 (SGN)
125522 (CGN)
---
Lycopersicon CombinedSingleSGN-U227989---
Solanum tuberosumSingleSGN-U257906---
ArabidopsisSingleAt2g34620 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25816)
Chromosome
2
Position
14.58 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41269
Forward primer (5'-3')
TTGCGAGAATAATCGGAATGTGTC
Accessions and product sizes
Solanum pennellii TA56
700
Solanum lycopersicum TA209
700
Approximate temperature
55°C
Reverse primer (5'-3')
TGAAAGTGAATAGTCCCGGACATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 32263
Forward primer (5'-3')
TTGCGAGAATAATCGGAATGTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAAGTGAATAGTCCCGGACATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32264
Forward primer (5'-3')
TTGCGAGAATAATCGGAATGTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAAGTGAATAGTCCCGGACATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32265
Forward primer (5'-3')
TTGCGAGAATAATCGGAATGTGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAAAGTGAATAGTCCCGGACATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At2g34620  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7397 marker 7397
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)