SGN Marker TG291

SGN-M74

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG291 image not available
Forward sequence
TAACTCAGGTTGGGATGATATTAACCACATTTTTGTTACATGGAATTTTGCTACTTATAGTTGGAAATATTTTGCTGCCTTTTTTGGGAT
TACTCATAGATATTAACCACATTTTTGTTACATGGAATTTTGCTACTTATAGTTGGAAATATTTTGCTGCCTTTTTTGGGATTACTCATA
GATATTAACCACATTTTTGTTACATGGAATTTTGCTACTTATACTTGGAAATATTTTGCTGCCTTTTTTGGGATTACTCATAGATATATG
CCCCTGGTAAGTCTTCTTATGGACTGGTGGAGTGGGAAATAAAAAAAATCAGCTTACAAGTTGTTACTTGAGACTCTCACAAGTAAGGGG
AGCGTCTCTATTGTAAGTTGTTTGATGCTTACTAGTTAATGTGTAATGAGAGGAGTCCTCTCTTTTAGGTGAATAGTTAGTAGGTTTACG
TTTNATTG
Reverse sequence
TTTCTTGTTTTTTCTCACTTTATAGGTCGTTTCTTCTGACTCACCTTTGCAACTCAATAATCATCATCTCAGCAAATGAAACTTGTTTTA
CCCTCCTCTTTTTCGCCTTCTATATTATTAATTACGGACTAGACTTTGCATCTCCAAGATCCATTCTCCTTGTTTCAGCAACAAGTAATT
TGTTCAATCATTTTAGCCAACACTTTGATCATCTGCAACTTGGCACTGGTTATATCAGGATTGGAGAACATAGGAGTTATTTGGCAGTGG
TACTAATTTCCCAGCCTTGGTTAGTTTCCAGCCTAGTTATGTTGCCAGTTTATAGTTATTAGCAGGAACTAGCTCCTTTCCCTGAATTAA
AGAATTGCCAACCTTGGTATGTTGCCCATTAGCATTCACATAACATATATATTCATGACTCATACATGTAGTCTCTGCTAAATTAAACCT
ACCTTCTTGCAGTATTAAGTTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1565811.4e-1081 (17.2% of RFLP seq)-
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43854)
Chromosome
9
Position
30.90 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43596)
Chromosome
9
Position
43.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43315)
Chromosome
9
Position
48.90 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40854)
Chromosome
9
Position
42.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7966)
Chromosome
9
Position
54.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7967)
Chromosome
9
Position
53.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG291 was used as an overgo probe on plate 16 [well E7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AATGAGAGGAGTCCTCTCTTTTAG
B sequence
CCTACTAACTATTCACCTAAAAGA
AB sequence
AATGAGAGGAGTCCTCTCTTTTAGGTGAAT
Marker sequence
TAACTCAGGTTGGGATGATATTAACCACATTTTTGTTACATGGAATTTTG
CTACTTATAGTTGGAAATATTTTGCTGCCTTTTTTGGGATTACTCATAGA
TATTAACCACATTTTTGTTACATGGAATTTTGCTACTTATAGTTGGAAAT
ATTTTGCTGCCTTTTTTGGGATTACTCATAGATATTAACCACATTTTTGT
TACATGGAATTTTGCTACTTATACTTGGAAATATTTTGCTGCCTTTTTTG
GGATTACTCATAGATATATGCCCCTGGTAAGTCTTCTTATGGACTGGTGG
AGTGGGAAATAAAAAAAATCAGCTTACAAGTTGTTACTTGAGACTCTCAC
AAGTAAGGGGAGCGTCTCTATTGTAAGTTGTTTGATGCTTACTAGTTAAT
GTGTAATGAGAGGAGTCCTCTCTTTTAGGTGAATAGTTAGTAGGTTTACG
TTTNATTG
Genomic location of TG291  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D74 marker 74
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)