SGN Marker SSR67

SGN-M740

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 60 High: 50
Repeat motif: AGA   Repeat number: 2
Repeat motif: AAG   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: GCACGAGACCAAGCAGATTA
Reverse primer: GGGCCTTTCCTCCAGTAGAC
Predicted size: 100
Derivations 
This marker was derived from EST read SGN-E50834
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39290)
Chromosome
11
Position
24.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 138
Forward primer (5'-3')
GCACGAGACCAAGCAGATTA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGGCCTTTCCTCCAGTAGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900+900
Solanum pennellii LA716: 900+1000
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR67 was used as an overgo probe on plate 9 [well H7]

Plausible BAC Matches:   P290P06,   P323C14,   P076E04,   P301I13,   P012D01,   P046H01,   P001N07,   P263D01,   P323A08,   P026G04,   P143B24,   P105F09,   P299H14,   P260G05,   P290B11,   P318G08,   P303J16,   P249E06,   P141B16,   P275E03,   P270O24

 Overgo Sequences

A sequence
AGATGGCTCGTACCAAGCAAACTG
B sequence
CCAGTAGACTTACGAGCAGTTTGC
AB sequence
AGATGGCTCGTACCAAGCAAACTGCTCGTA
Marker sequence
GCACGAGACCAAGCAGATTAAGAAGAAGAAGAAGAAGAAGAGAAGAAAAA
GATGGCTCGTACCAAGCAAACTGCTCGTAAGTCTACTGGAGGAAAGGCCC
CTAGGAAGCAACTTGCTACCAAGGCTGCTCGTAAGTCTGCTCCTACTACA
GGTGGAGTGAAGAAGCCTCACAGATACCGCCCTGGTACTGTTGCTCTTCG
TGAAATCCGTAAGTACCAGAAGAGTACTGAGCTCTTGATCAGGAAGCTTC
CCTTCCAGAGGCTTGTTCGTGAAATTGCCCAGGACTTCAAGACTGATCTG
CGTTTCCAGAGTCATGCTGTGTTGGCTCTTCAAGAGGCTGCTGAGGCCTA
CTTGGTTGGTCTGTTTGAGGACACCAATCTTTGTGCCATTCATGCCAAGC
GTGTGACCATTATGCCCAAGGACATTCAGCTTGCTAGGCGTATTANGGGC
GAGCGTGCTTAAGTTGATCAACCATGGCAGTTCTATTGTTGCTCTTTTTA
GATTTTTCTTTTTGTGAAGACTTAAAAAGTTGGTAATGAAATCTAATAGT
AGGGATAATGTCGTATGTTGATGCTTA
Genomic location of SSR67  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D740 marker 740
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)