Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

SGN Marker C2_At2g36835

SGN-M7420
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204108---
Lycopersicon CombinedSingleSGN-U230736---
Solanum tuberosumSingleSGN-U246987---
ArabidopsisSingleAt2g36835 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25840)
Chromosome
2
Position
15.46 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41277
Forward primer (5'-3')
AGCTGCTGCCTTACAGAAAGATGTTC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AATCCACTTCCAATTGGATCTGGATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At2g36835  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7420 marker 7420
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)