SGN Marker SSR70

SGN-M743

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 60 High: 55
Repeat motif: AT   Repeat number: 20
Repeat motif:    Repeat number:
Forward primer: TTTAGGGTGTCTGTGGGTCC
Reverse primer: GGAGTGCGCAGAGGATAGAG
Predicted size: 120
Derivations 
This marker was derived from EST read SGN-E161275
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43820)
Chromosome
9
Position
17.80 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44840
Forward primer (5'-3')
TTTAGGGTGTCTGTGGGTCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGAGTGCGCAGAGGATAGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43280)
Chromosome
9
Position
31.00 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44654
Forward primer (5'-3')
TTTAGGGTGTCTGTGGGTCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGAGTGCGCAGAGGATAGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39292)
Chromosome
9
Position
42.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14135
Forward primer (5'-3')
TTTAGGGTGTCTGTGGGTCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGAGTGCGCAGAGGATAGAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 120
Solanum pimpinellifolium LA1589: 104+120
Approximate temperature
50°C
  
PCR data   Exp. ID 113
Forward primer (5'-3')
TTTAGGGTGTCTGTGGGTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGAGTGCGCAGAGGATAGAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 120+120
Solanum pennellii LA716: 93+120
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR70 was used as an overgo probe on plate 16 [well D3]

Plausible BAC Matches:   P153F02,   P121A19,   P243L15

 Overgo Sequences

A sequence
CGTACACTCTATCCTCTGCGCACT
B sequence
AGAATCCCACAAGTGGAGTGCGCA
AB sequence
CGTACACTCTATCCTCTGCGCACTCCACTT
Marker sequence
GATCAAGCTAGCCAACACTATTATCAATACCAATTTCAGTATTCAAAGCC
TCATGTTGCTGTTTCAGCTACTGCTTCTTCCTATAATAATAACCATCACA
ATCACAAGGATATGAATTTCTCAAGAGATGTCAACCAGATGAGATATCAC
CAGGGATAAGATCTGTAGATTTGACAACCAGGATTGACTATTACAGGCAC
TTGGAATTTATTTTTAGTTTTTTCTTTAAAGAAAAAATTCTTGAAAAAAT
AGGAAAAGAAAATCCAAAAAGGGTAAAAATCCCAGATTTTCTGGCAACTT
TCTCCCCCTAGAAAAAGGTAGTATATATCACAGAACTTTTAACACCTATT
CCAAGTCCACAGGAAATTGAAAGAATGAAAATATTGGAGATGAAACTTTG
AAAGAGACTTTAGGGTGTCTGTGGGTCCATCAGATTATAGCTGAAGAGAT
GAAAGAATATATATATATATATATATATATATATATATATATATATGGTC
TACGTACACTCTATCCTCTGCGCACTCCACTTGTGGGATTCTGTCGGGGT
ATTTTGTTGTATTTTGGTTGCTACTGTGGAGATTCTGCCTGAAGATTTTT
GTTAGGGGGCTTCATCATAATCATGACAATTGACCAAAACTGAAGGATAG
TAATAGTGAGAAGAAGAAGAAAGATGGTTCTTTTACCAAGTGGTGATGGT
AGTGGTAGTGGG
Genomic location of SSR70  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D743 marker 743
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)