SGN Marker C2_At2g37500

SGN-M7430
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201280---
Lycopersicon CombinedSingleSGN-U231168---
Solanum tuberosumSingleSGN-U252001---
ArabidopsisSingleAt2g37500 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46640)
Chromosome
7
Position
62.10 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46471)
Chromosome
7
Position
69.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42202)
Chromosome
9
Position
38.30 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43767
Forward primer (5'-3')
TGTTTAGAATTCTTACCTCCTTTGCCG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCACTCAATTACATCTTGATAACCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38368)
Chromosome
9
Position
37.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39621
Forward primer (5'-3')
TCCTGGTGGTGTTACTGCTGCAAAG
Accessions and product sizes
Solanum lycopersicum TA209
800
Solanum pennellii TA56
800
Approximate temperature
55°C
Reverse primer (5'-3')
AGCACTCAATTACATCTTGATAACCTGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
270+530
Solanum pennellii TA56
800
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25850)
Chromosome
2
Position
15.75 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32280
Forward primer (5'-3')
TCCTGGTGGTGTTACTGCTGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCACTCAATTACATCTTGATAACCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32281
Forward primer (5'-3')
TCCTGGTGGTGTTACTGCTGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCACTCAATTACATCTTGATAACCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32282
Forward primer (5'-3')
TCCTGGTGGTGTTACTGCTGCAAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCACTCAATTACATCTTGATAACCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32283
Forward primer (5'-3')
TCCTGGTGGTGTTACTGCTGCAAAG
Digested band sizes (using DraI)
Solanum pennellii LA716: 150+350+500
Solanum lycopersicum LA925: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCACTCAATTACATCTTGATAACCTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AseI,DraI
All possible enzymes for lycopersicum and pimpinellifolium: AseI
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text

Genomic location of C2_At2g37500  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7430 marker 7430
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)