SGN Marker C2_At2g38270

SGN-M7441
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303556 (SGN)
122552 (CGN)
---
Capsicum annuumSingleSGN-U196465---
Lycopersicon CombinedSingleSGN-U222884---
Solanum tuberosumSingleSGN-U253332---
ArabidopsisSingleAt2g38270 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38373)
Chromosome
9
Position
0.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39625
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
Accessions and product sizes
Solanum pennellii TA56
2000
Solanum lycopersicum TA209
2000
Approximate temperature
55°C
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
900
Solanum pennellii TA56
950
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25862)
Chromosome
2
Position
16.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10822
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 10823
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 10824
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 13056
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 13057
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13058
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13059
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13060
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13061
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 350+500
Approximate temperature
55°C
  
PCR data   Exp. ID 13062
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13063
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 13064
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32957
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32958
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32959
Forward primer (5'-3')
ACGCAACATCGCCGCCAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCATTACCCGGTGGTACCTTTCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At2g38270  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7441 marker 7441
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)