SGN Marker SSR72

SGN-M745

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 52.381
Repeat motif: ATTC   Repeat number: 2
Repeat motif: AC   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: GGTTCCCTTCTCTCTTTGTCC
Reverse primer: GCGTGTTCTTCGATTTGACA
Predicted size: 182
Derivations 
This marker was derived from EST read SGN-E161108
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53502)
Chromosome
4
Position
0.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39293)
Chromosome
4
Position
0.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31915
Forward primer (5'-3')
GGTTCCCTTCTCTCTTTGTCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCGTGTTCTTCGATTTGACA
Enzymes
  
Accessions and product sizes
Approximate temperature
52°C
  
Overgo hybridization and physical mapping 
SSR72 was used as an overgo probe on plate 1 [well C2]

Plausible BAC Matches:   P330P03,   P217A20,   P145O01,   P090J13

 Overgo Sequences

A sequence
TTATCCCTGAAAGCCGGAGCACTA
B sequence
ACCTTATCGGAACTCCTAGTGCTC
AB sequence
TTATCCCTGAAAGCCGGAGCACTAGGAGTT
Marker sequence
CCTTCTAATCTTCTTCATATGGTTCCCTTCTCTCTTTGTCCATAACTTGT
CTCTCAAATAGTTATCATCCTCTTCTCTTTTTAAACTCCCCACAACACAC
ACACACACATTCATTCAAACAACATATTCTATCTATTGACACCTTAATTA
ACACAAATTCTTGCCTTCTTAACACAGTATAATGTCAAATCGAAGAACAC
GCGGTTCGAGACAATCATCAGGAGCTTCTAGAATAAGTGATGATCAAATT
GCTGATCTCGTATCAAAGTTACAATTACTTATCCCTGAAAGCCGGAGCAC
TAGGAGTTCCGATAAGGTAGTATTTTTCAGTTTAAGTTATATATACCGAC
AGTTTGAATTCCTTAGTTATATATAAGCATGTTGAATTGTACTTGTTGTG
GTACATTCACACATTTTGACAATGTTATTTGGTTACATTTTGTTTGTTCT
CTTCTTTTACTTGCTATAAACTATATATGTTGTGTTTGTAAAAATGAATT
GAATTATATTTTTCCTTGAAGCCATTCATATTTTTTTGTGGCCTTCATTA
TCTTTTTAGGGATAAGTTTAATTTGAAAGTCATATTCTCATGCCCACTAT
GCCATATTGCAAGCTCCCTCATTTAATA
Genomic location of SSR72  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D745 marker 745
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)