Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker SSR73

SGN-M746

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: AG   Repeat number: 2
Repeat motif: AGA   Repeat number: 7
Repeat motif: TAGTGA   Repeat number: 2
Repeat motif:    Repeat number:
Forward primer: TGGGAAGATCCTGATGATGG
Reverse primer: TTCCCTTTCCTCTGGACTCA
Predicted size: 198
Derivations 
This marker was derived from EST read SGN-E158145
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39294)
Chromosome
9
Position
32.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 111
Forward primer (5'-3')
TGGGAAGATCCTGATGATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCCCTTTCCTCTGGACTCA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700+700
Solanum pennellii LA716: 700+1300
Approximate temperature
45°C
  
Overgo hybridization and physical mapping 
SSR73 was used as an overgo probe on plate 15 [well D3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACAGTTACAGCTACGGCTTATACC
B sequence
AGCAGCTAAACCTGCAGGTATAAG
AB sequence
ACAGTTACAGCTACGGCTTATACCTGCAGG
Marker sequence
ATGGCCAATGACAGTTACAGCTACGGCTTATACCTGCAGGTTTAGCTGCT
CTAATGTTGTTTCTCACAGATTTACAAGAAGAATTAACATGGGGTTTCGT
TCTTTTCAAGAAATTTCTACAAGGAATAGTGTTGTTAACTTAAGAAAAGC
TCATTTTTGGGAAGATCCTGATGATGGTAGTGATAGTGAAGAAGAAGAAG
AAGAAGAAGAGGAGAGGGAAGAAGATATGGATGTTGAGAGTAGCTTTGAA
TATGAAGAAAATAGAGCTATGGACAATTCTACAAATGGTTTGTCTAACAG
GGAAGATGAGTTTGTGAAAGAAGTTGAACAGCTTTTGAGTCCAGAGGAAA
GGGAAATTTTGTATCACAATCAAACTCCAGAGCTGGATAAGATATCAACT
GAAAAATGGAACCCTCTTCACACTTTTGCACTAGCAGGGCAGATACGATT
TATGGATAGACTTCTAGAGGAGGGTCTTGATATTGATGCCGTTGACAAGG
AAGGGCAAACAGCTCTTCACCATGCCG
Genomic location of SSR73  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D746 marker 746
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)