SGN Marker C2_At2g39580

SGN-M7462
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301400 (SGN)
122461 (CGN)
---
Lycopersicon CombinedSingleSGN-U220899---
ArabidopsisSingleAt2g39580 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46643)
Chromosome
4
Position
18.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46473)
Chromosome
4
Position
14.20 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41390)
Chromosome
5
Position
14.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43366
Forward primer (5'-3')
AGATAACTGGTTTGACGAAGTTCCTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGAAGCTTCTACCCATACATATTCTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38377)
Chromosome
4
Position
27.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41292
Forward primer (5'-3')
AGATAACTGGTTTGACGAAGTTCCTGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGAAGCTTCTACCCATACATATTCTGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25884)
Chromosome
2
Position
16.52 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 43768
Forward primer (5'-3')
AGATAACTGGTTTGACGAAGTTCCTGG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGAAGCTTCTACCCATACATATTCTGG
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g39580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7462 marker 7462
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)