SGN Marker C2_At2g39690

SGN-M7463
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U205160---
Lycopersicon CombinedSingleSGN-U226878---
ArabidopsisSingleAt2g39690 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109231)
Chromosome
6
Position
21.51 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49236)
Chromosome
6
Position
2.46 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47167)
Chromosome
6
Position
4.80 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42203)
Chromosome
6
Position
6.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43769
Forward primer (5'-3')
TGGTCTTGAATATCCAGAACCTAATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATTCTGAAGCATAAGGTTGAACCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41391)
Chromosome
6
Position
8.80 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43367
Forward primer (5'-3')
TGGTCTTGAATATCCAGAACCTAATG
Accessions and product sizes
Approximate temperature
53°C
Reverse primer (5'-3')
CTCTGTCTGTTAAATTTGACGAAAAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38378)
Chromosome
6
Position
5.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39628
Forward primer (5'-3')
TGGTCTTGAATATCCAGAACCTAATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATTCTGAAGCATAAGGTTGAACCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25885)
Chromosome
2
Position
16.55 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32295
Forward primer (5'-3')
TGGTCTTGAATATCCAGAACCTAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTCTGAAGCATAAGGTTGAACCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32296
Forward primer (5'-3')
TGGTCTTGAATATCCAGAACCTAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTCTGAAGCATAAGGTTGAACCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32297
Forward primer (5'-3')
TGGTCTTGAATATCCAGAACCTAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTCTGAAGCATAAGGTTGAACCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32298
Forward primer (5'-3')
TGGTCTTGAATATCCAGAACCTAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTCTGAAGCATAAGGTTGAACCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: BstUI,BtgI,NsiI,SacII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At2g39690  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7463 marker 7463
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)