SGN Marker SSR74

SGN-M747

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 50
Repeat motif: TCT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: ACTCACCATGGCTGCTTCTT
Reverse primer: TTTCTTGAAGGGTCTTTCCC
Predicted size: 199
Derivations 
This marker was derived from EST read SGN-E157993
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39295)
Chromosome
10
Position
74.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14146
Forward primer (5'-3')
ACTCACCATGGCTGCTTCTT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTTCTTGAAGGGTCTTTCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 199+200
Solanum pimpinellifolium LA1589: 199+203
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR74 was used as an overgo probe on plate 15 [well C10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAATATCCATTGCCGGAGTCCCTT
B sequence
AATTGAGGAGCCATGGAAGGGACT
AB sequence
GAATATCCATTGCCGGAGTCCCTTCCATGG
Marker sequence
GAGAATATCCATTGCCGGAGTCCCTTCCATGGCTCCTCAATTTCTCTCTA
TCTTCTAAATTTCACACTTCTCTGCTCACTGAGCTAATCAAATCAAATAT
ATTTAACATCATTATCCAAATAACTCACCATGGCTGCTTCTTCTCTGTTT
ATAAATCCTGTCATCTCTTCTTCTTCTTCTTCTTCTTTTGTTTCAGTACC
TACTAGTTTTCATGATTTTTCTCACTTTTCTACTTCAAGAACAAACCCCA
TTAGCTTAATTTGTACAAAAGACAATTTTTTGCAGTGTGAGAGGAGATTT
AGGGAAAGACCCTTCAAGAAAAGACCCTTAATTGCAGCTAGCAACATGAA
AGGTAAAGAATATAGGGAAGAAGAGGAAGAGGGTCCTCCTCCTTTGGTTG
AATCTGAAACGACTTCGAAGCCTAGACGTATTGCTATCTTCGTTGAGCCT
TCTCCTTTTTCGTATGTATCTGGCTATAAGAACCGGTTCCAGAATTTTAT
AAGATATCTCCGTGAAATGGGGGATGAGGTTATGGGTTGTGACAACACAT
GAAGGAGTACCTCAAGAGTTTTATGGAGCAAAGTTGATTGGATCAAGAAG
TTTTCCTTGCCCCTTGTACGAAGAGGTGCCCCTGTCACTAGCCCTCAGCC
CAAGATAATTTCAGAAGTAGCACGATTCAAGCCCGACATCATACATGCAT
CATCTCCTGGTATAATGGTGATTTGG
Genomic location of SSR74  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D747 marker 747
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)