SGN Marker C2_At2g41680

SGN-M7484
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306554 (SGN)
131611 (CGN)
---
Lycopersicon CombinedSingleSGN-U221908---
ArabidopsisSingleAt2g41680 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38383)
Chromosome
9
Position
15.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39632
Forward primer (5'-3')
TCTGTGGAAGGTGTATTTGCAGC
Accessions and product sizes
Solanum lycopersicum TA209
880
Solanum pennellii TA56
880
Approximate temperature
55°C
Reverse primer (5'-3')
AGTGATGGCTTGCCTCCATTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
650
Solanum pennellii TA56
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25907)
Chromosome
2
Position
17.38 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10844
Forward primer (5'-3')
TCTGTGGAAGGTGTATTTGCAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTGATGGCTTGCCTCCATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 10845
Forward primer (5'-3')
TCTGTGGAAGGTGTATTTGCAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTGATGGCTTGCCTCCATTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 10846
Forward primer (5'-3')
TCTGTGGAAGGTGTATTTGCAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTGATGGCTTGCCTCCATTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 10847
Forward primer (5'-3')
TCTGTGGAAGGTGTATTTGCAGC
Digested band sizes (using ApoI)
Solanum lycopersicum LA925: 290
Solanum pennellii LA716: 150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTGATGGCTTGCCTCCATTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI
  
Accessions and product sizes
Solanum pennellii LA716: 600
Solanum lycopersicum LA925: 600
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g41680F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At2g41680  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7484 marker 7484
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)