SGN Marker SSR76

SGN-M749

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 45
Repeat motif: CGG   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: ACGGGTCGTCTTTGAAACAA
Reverse primer: CCACCGGATTCTTCTTCGTA
Predicted size: 199
Derivations 
This marker was derived from EST read SGN-E156186
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43821)
Chromosome
11
Position
36.80 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44842
Forward primer (5'-3')
ACGGGTCGTCTTTGAAACAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCACCGGATTCTTCTTCGTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43281)
Chromosome
11
Position
29.30 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44656
Forward primer (5'-3')
ACGGGTCGTCTTTGAAACAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCACCGGATTCTTCTTCGTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-LXCHM 2007   
Map version
68 (location: 43004)
Chromosome
11
Position
29.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 44004
Forward primer (5'-3')
ACGGGTCGTCTTTGAAACAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCACCGGATTCTTCTTCGTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39297)
Chromosome
11
Position
37.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 139
Forward primer (5'-3')
ACGGGTCGTCTTTGAAACAA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CCACCGGATTCTTCTTCGTA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 199+220
Solanum lycopersicum LA925: 199+199
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR76 was used as an overgo probe on plate 10 [well D8]

Plausible BAC Matches:   P318J08

 Overgo Sequences

A sequence
CCAACTCAGGTTCTGAGAAATCCG
B sequence
GAACCATTACCACCACCGGATTTC
AB sequence
CCAACTCAGGTTCTGAGAAATCCGGTGGTG
Marker sequence
GCCCAACTCAGGTTCTGAGAAATCCGGTGGTGGTAATGGTTCGAAAAGTT
TTTCCGCCGTACACGCCGTTGCTCACGGCGGCGTTCATGGCGGTGCTGAC
CATTTGAGCTCGTTTAACTGCTATTGTTTCAGCTGTTATATGAGTTATTG
GGTGAAATGGGATTCTTCACCAAATCGACAGCTTATTCATGAAATTCTTG
ATGCTTATGAAGATGGGTTGCAGAGCAAAAAGGAAAAGAGTAAAAAAGAA
CGGAGAAACAAAAACGGGTCATCTTTGAAGCAAAACGGGTCGTCTTTGAA
ACAAAACGGGTCATCTAATGGTGATGTTGGGTCTTCTACTGAGCTGAAAA
AGTCATCATCTGAGTTATCTTTGAACAAAAATGGTTCCGGGTCAGTGTCT
GGATTCGGGTCGGGTCAAGCTGACCCGGTTGAGGAAACTTCCGGCGGCGG
CGGCGGCGGCGGTTACGAAGAAGAATCCGGTGGAGTCGAAAAGGGAACCG
TAAGAAAGTTTGTGAGTTTTCTTGGTGAAAGGATTTGGAGTGTTTGGACC
TAAAAACAAAAAAATATTTTAGGGTTGGTTTATTTTTAAATTTTTTTTCT
ATCTCCATTTCCACTTTAATCATCTCATAATAGTTTTTTTTTTTTTTGAA
ATTCTGGTCTGTAAAATACCCTTTTACTTCACAATGTAAAATATTGGGTA
GTAATTTTGAA
Genomic location of SSR76  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D749 marker 749
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)