SGN Marker C2_At2g42620

SGN-M7498
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310554 (SGN)
128140 (CGN)
---
Lycopersicon CombinedSingleSGN-U226246---
ArabidopsisSingleAt2g42620 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38386)
Chromosome
12
Position
46.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39635
Forward primer (5'-3')
AGAGAGGGCATTTGGATTGAGCAC
Accessions and product sizes
Solanum pennellii TA56
1300
Solanum lycopersicum TA209
1300
Approximate temperature
58°C
Reverse primer (5'-3')
AGCGGCTCAAGGAGTCTGACCTCATTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
600
Solanum pennellii TA56
1200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25921)
Chromosome
2
Position
17.76 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g42620  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7498 marker 7498
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)