SGN Marker C2_At2g44050

SGN-M7511
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302259 (SGN)
123193 (CGN)
---
Capsicum annuumSingleSGN-U204138---
Solanum tuberosumSingleSGN-U254047---
ArabidopsisSingleAt2g44050 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25935)
Chromosome
2
Position
18.23 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41304
Forward primer (5'-3')
AGCTTTTGGAGGGAGCTTTG
Accessions and product sizes
Solanum pennellii TA56
450
Solanum lycopersicum TA209
450
Approximate temperature
55°C
Reverse primer (5'-3')
TGCGTGATATTTCTGTGACTTTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10864
Forward primer (5'-3')
AGCTTTTGGAGGGAGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCGTGATATTTCTGTGACTTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 10865
Forward primer (5'-3')
AGCTTTTGGAGGGAGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCGTGATATTTCTGTGACTTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 10866
Forward primer (5'-3')
AGCTTTTGGAGGGAGCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCGTGATATTTCTGTGACTTTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At2g44050F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At2g44050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7511 marker 7511
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)