SGN Marker SSR80

SGN-M753

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40.909 High: 45
Repeat motif: TTTCAA   Repeat number: 2
Repeat motif: GTACAA   Repeat number: 2
Repeat motif: CAA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: GGCAAATGTCAAAGGATTGG
Reverse primer: AGGGTCATGTTCTTGATTGTCA
Predicted size: 186
Derivations 
This marker was derived from EST read SGN-E152575
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53503)
Chromosome
11
Position
11.99 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43822)
Chromosome
11
Position
17.20 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44843
Forward primer (5'-3')
GGCAAATGTCAAAGGATTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGGTCATGTTCTTGATTGTCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43282)
Chromosome
11
Position
16.80 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44657
Forward primer (5'-3')
GGCAAATGTCAAAGGATTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGGTCATGTTCTTGATTGTCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40772)
Chromosome
11
Position
14.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39298)
Chromosome
11
Position
20.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 137
Forward primer (5'-3')
GGCAAATGTCAAAGGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGTCATGTTCTTGATTGTCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 186+175
Solanum lycopersicum LA925: 186+186
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR80 was used as an overgo probe on plate 9 [well G11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GACCACTGCCTCAATGGCAACATC
B sequence
TTGAGTTGTGGTGGTGGATGTTGC
AB sequence
GACCACTGCCTCAATGGCAACATCCACCAC
Marker sequence
GGTGATTTCAGCTCATGAGGAACTTGCAAGAAAAGATGAGGAGATTTTGC
AACTTAAGGATCTATTGACTAGAGTTATGAAAGAAAGAGATGAAATACAA
GGCAAATGTCAAAGGATTGGAATGGAGAAAATTATACTACAACAACAATT
GCTCCAACAACAACAACAACAACAAGTACAAGTACAATTTCAATTTCAAA
AACATAACCAAAATAATGTTGTTATAGAAAGTGCACCTATTTCTAGTGGC
ACAACAATTAGTCATGACAATCAAGAACATGACCCTATTTTAAAAGGGGT
AGTTGACTCTAACCACAACAACAACATTTGTGTACTTTCTAATTCCTCAG
ATTGTGATGAAAACAATGTTGTTTCACCACCATTATTAGTCCAAGATTTA
ATTGAAAATGTTGTAATCAAGAAGCCATTGCCAGAGAAGGGGAAATTCTT
GCAAGCTGTGATGGAAGCAGGGCCATTACTTCAAACACTTTTACTAGCAG
GACCACTGCCTCAATGGCAACATCCACCACCACAACTCAATTCAATTGAC
ATTCCTCCGGTCACTATTGCCTCCCCTACTCCGCGTTTGCTACATCAGGA
CTCTGCCCT
Genomic location of SSR80  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D753 marker 753
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)