SGN Marker C2_At2g46370

SGN-M7545
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300785 (SGN)
124881 (CGN)
---
Capsicum annuumSingleSGN-U203493---
ArabidopsisSingleAt2g46370 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46648)
Chromosome
8
Position
26.80 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46475)
Chromosome
8
Position
21.90 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38400)
Chromosome
10
Position
25.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39646
Forward primer (5'-3')
AGCTTGTTGTTGACATAAGAGAGGGAG
Accessions and product sizes
Solanum lycopersicum TA209
450
Solanum pennellii TA56
450
Approximate temperature
55°C
Reverse primer (5'-3')
TGCAAAACTTGTAACGACAATTTCATAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
150+250
Solanum lycopersicum TA209
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25969)
Chromosome
2
Position
19.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10889
Forward primer (5'-3')
AGCTTGTTGTTGACATAAGAGAGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAAACTTGTAACGACAATTTCATAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10890
Forward primer (5'-3')
AGCTTGTTGTTGACATAAGAGAGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAAACTTGTAACGACAATTTCATAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10891
Forward primer (5'-3')
AGCTTGTTGTTGACATAAGAGAGGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAAAACTTGTAACGACAATTTCATAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g46370F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At2g46370  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7545 marker 7545
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)