SGN Marker C2_At2g46820

SGN-M7549
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300403 (SGN)
120672 (CGN)
---
Lycopersicon CombinedSingleSGN-U214743---
Solanum tuberosumSingleSGN-U258164---
ArabidopsisSingleAt2g46820 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38402)
Chromosome
10
Position
0.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39648
Forward primer (5'-3')
TGGCATCGTCGCAATGTGTGAC
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
58°C
Reverse primer (5'-3')
AAGCTCTGATGGTAGCTCAGTGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
750
Solanum pennellii TA56
650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25973)
Chromosome
2
Position
19.25 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10892
Forward primer (5'-3')
TGGCATCGTCGCAATGTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTGATGGTAGCTCAGTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10893
Forward primer (5'-3')
TGGCATCGTCGCAATGTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTGATGGTAGCTCAGTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10894
Forward primer (5'-3')
TGGCATCGTCGCAATGTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTGATGGTAGCTCAGTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32627
Forward primer (5'-3')
TGGCATCGTCGCAATGTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTGATGGTAGCTCAGTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32979
Forward primer (5'-3')
TGGCATCGTCGCAATGTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTGATGGTAGCTCAGTGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32980
Forward primer (5'-3')
TGGCATCGTCGCAATGTGTGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTGATGGTAGCTCAGTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 10895
Forward primer (5'-3')
TGGCATCGTCGCAATGTGTGAC
Digested band sizes (using HinfI)
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCTCTGATGGTAGCTCAGTGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
All possible enzymes for lycopersicum and pimpinellifolium: HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At2g46820  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7549 marker 7549
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)