SGN Marker C2_At2g47020

SGN-M7553
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309069 (SGN)
126614 (CGN)
---
Lycopersicon CombinedSingleSGN-U223409---
Solanum tuberosumMultipleSGN-U246186---
ArabidopsisSingleAt2g47020 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 25977)
Chromosome
2
Position
19.33 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10902
Forward primer (5'-3')
AGTAGATCGAAACTTCGACTGGAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGCAATCGCGTCCATTTCCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 380
Approximate temperature
53°C
  
PCR data   Exp. ID 10903
Forward primer (5'-3')
AGTAGATCGAAACTTCGACTGGAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGCAATCGCGTCCATTTCCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 380
Approximate temperature
53°C
  
PCR data   Exp. ID 10904
Forward primer (5'-3')
AGTAGATCGAAACTTCGACTGGAGCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATGCAATCGCGTCCATTTCCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 380
Approximate temperature
53°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At2g47020F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At2g47020  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7553 marker 7553
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)