SGN Marker C2_At3g01180

SGN-M7576
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201005---
Lycopersicon CombinedMultipleSGN-U217153---
Solanum tuberosumSingleSGN-U255639---
ArabidopsisSingleAt3g01180 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46649)
Chromosome
2
Position
7.30 cM
Confidence
CF(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46476)
Chromosome
2
Position
16.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38411)
Chromosome
2
Position
102.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41320
Forward primer (5'-3')
TCTGTCCTGGTGATTCATAACATCGC
Accessions and product sizes
Solanum lycopersicum TA209
225
Solanum pennellii TA56
225
Approximate temperature
55°C
Reverse primer (5'-3')
ACCACTCTTCGGAAGTCTTAGTTCCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
150
Solanum lycopersicum TA209
225
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26000)
Chromosome
3
Position
0.06 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g01180  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7576 marker 7576
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)