SGN Marker C2_At3g01440

SGN-M7578
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312035 (SGN)
125494 (CGN)
---
Lycopersicon CombinedSingleSGN-U230677---
ArabidopsisSingleAt3g01440 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38413)
Chromosome
10
Position
3.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39658
Forward primer (5'-3')
ACAACAAATTTAAACATTATATTTGAAGC
Accessions and product sizes
Solanum lycopersicum TA209
450
Solanum pennellii TA56
450
Approximate temperature
55°C
Reverse primer (5'-3')
TCAAATAATCGATTAGCAAGATCAGTGAG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
450
Solanum lycopersicum TA209
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26002)
Chromosome
3
Position
0.17 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32319
Forward primer (5'-3')
ACAACAAATTTAAACATTATATTTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATAATCGATTAGCAAGATCAGTGAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32320
Forward primer (5'-3')
ACAACAAATTTAAACATTATATTTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATAATCGATTAGCAAGATCAGTGAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32321
Forward primer (5'-3')
ACAACAAATTTAAACATTATATTTGAAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATAATCGATTAGCAAGATCAGTGAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32322
Forward primer (5'-3')
ACAACAAATTTAAACATTATATTTGAAGC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 175+200+650
Solanum pennellii LA716: 200+325
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAAATAATCGATTAGCAAGATCAGTGAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g01440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7578 marker 7578
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)