SGN Marker SSR85

SGN-M758

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 50
Repeat motif: TAA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: ATCCGTTAGCTATTGTGCCG
Reverse primer: TTGCCATGCACTTATCTTCG
Predicted size: 179
Derivations 
This marker was derived from EST read SGN-E62108
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39299)
Chromosome
10
Position
55.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 131
Forward primer (5'-3')
ATCCGTTAGCTATTGTGCCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCCATGCACTTATCTTCG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 170+179
Solanum lycopersicum LA925: 179+179
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR85 was used as an overgo probe on plate 16 [well F1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCGCCGATAGAAGAAACAAATCCG
B sequence
CCGGCACAATAGCTAACGGATTTG
AB sequence
GCGCCGATAGAAGAAACAAATCCGTTAGCT
Marker sequence
TTATCAAACACCTCATACCCTAGTAAACACTACTACCACCAGCACCAATT
ACAACACCAACACTACAACAGAAAATCATCAAGAAGATGAACAACAAATC
AGAGATATACATGCTTTAACCCCACCAAGACCTCCATCAAATAGTGGCCG
TCGAATCGAAACTTGGGAAACAAGTAGCCATAGATCATCATCAATTTCCG
AAGTAGCATCTAGTGAGAATTTCTCTACTATGAGCCGGGAGTTCAGCGCC
CTCGTTCTCGCGGGATCGTCAGTTAGCAACAATCCCGCTAGCGAGAACGA
GGTGAATAATCATATATATAATAACAACAATTATAATAGCAATAATTTGG
GGAGCATCGGCGAAGAAGAAAATGATGCGCCGATAGAAGAAACAAATCCG
TTAGCTATTGTGCCGGATAATTATAGTAATACTTTAGATCCGATTATTGT
TAATCCTTCAAGAAGGATTAATAATAATAATAATAATAATGTTTTGAGAA
ATAATATTGGAGAAGTAAGTAGTGTTCAAAGAGTGAAAAAAGAAGAAATT
GAATCGAAGATAAGTGCATGGCAAAATGCTAAAATTTCGAAGATTAATAA
TAGGTTTAAACGTGAAGATGCTGTTATTAATGGATGGGAAAGGGAAGAAG
TACAAAAAGCTACTTCTTGGATG
Genomic location of SSR85  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D758 marker 758
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)