SGN Marker SSR86

SGN-M759

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 60 High: 45
Repeat motif: AG   Repeat number: 10
Repeat motif:    Repeat number:
Forward primer: AGGGCAACAAATCCCTCTTT
Reverse primer: GGAGACGAGGCTGCTTACAC
Predicted size: 210
Derivations 
This marker was derived from EST read SGN-E61559
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39300)
Chromosome
3
Position
54.00 cM
Confidence
I
Protocol
SSR
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39301)
Chromosome
4
Position
50.50 cM
Confidence
I
Protocol
SSR
Subscript
B


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14093
Forward primer (5'-3')
AGGGCAACAAATCCCTCTTT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGAGACGAGGCTGCTTACAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 204+210
Solanum pimpinellifolium LA1589: 208+210
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR86 was used as an overgo probe on plate 6 [well D8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P071A03,   P314J02,   P288C07

 Overgo Sequences

A sequence
CTCTTTGCGGTACTGAAAGAGCTG
B sequence
ATAAACTCACCGGCCACAGCTCTT
AB sequence
CTCTTTGCGGTACTGAAAGAGCTGTGGCCG
Marker sequence
CTAAATAGGGCAACAAATCCCTCTTTGCGGTACTGAAAGAGCTGTGGCCG
GTGAGTTTATCCCTCTCTCTCGTCGGAGAGACGAAGAAGATAACATACAG
AGAGAGAGAGAGAGAGAGCGGAATGGGACGAGAAGGAGATTGGGAGTGTA
GTAGCTGCGGTAATAAGAATTATGCCTTCAGATGTTTCTGCAATAGGTGT
AAGCAGCCTCGTCTCCTTGTTGACAACAAAACTCCTCATGATTCAAAGTG
GTTTCCTCGAATTGGCGATTGGATCTGCACTGGTTGCACTAACAACAATT
ATGCATCAAGAGAGAAGTGCAAAAAATGTGGACAACCAAAGGAGGTAGCA
GCAATGCCAGCAATTGCAATCCCTGGAGCATCTCTCCCATCTCATCCAAA
TTATTTTGCCAGGACACAAGGAGGTATGGAACAAAGGTTGAAAATTGGGT
TCTTAGGACATGGAGCT
Genomic location of SSR86  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D759 marker 759
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)