SGN Marker C2_At3g02360

SGN-M7592
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307588 (SGN)
131969 (CGN)
---
Capsicum annuumSingleSGN-U197867---
ArabidopsisSingleAt3g02360 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26016)
Chromosome
3
Position
0.48 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41326
Forward primer (5'-3')
TATGCTTCGAAAATATGTAGCTATGC
Accessions and product sizes
Solanum pennellii TA56
525
Solanum lycopersicum TA209
500
Approximate temperature
53°C
Reverse primer (5'-3')
TTCGACTGTTTGGCAATCTTGAACC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
525
Solanum lycopersicum TA209
500
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g02360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7592 marker 7592
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)