SGN Marker C2_At3g02420

SGN-M7593
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple299957 (SGN)
122836 (CGN)
---
Capsicum annuumSingleSGN-U198297---
Lycopersicon CombinedSingleSGN-U214197---
Solanum tuberosumMultipleSGN-U246624---
ArabidopsisSingleAt3g02420 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38417)
Chromosome
3
Position
72.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39662
Forward primer (5'-3')
ACGAGAATGATCCGAGATGGGC
Accessions and product sizes
Solanum lycopersicum TA209
2100
Solanum pennellii TA56
1750
Approximate temperature
55°C
Reverse primer (5'-3')
AGAAGGTGTTGAGGACGATGATGATG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
2100
Solanum pennellii TA56
1750
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26017)
Chromosome
3
Position
0.50 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10933
Forward primer (5'-3')
ACGAGAATGATCCGAGATGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAGGTGTTGAGGACGATGATGATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10934
Forward primer (5'-3')
ACGAGAATGATCCGAGATGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAGGTGTTGAGGACGATGATGATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10935
Forward primer (5'-3')
ACGAGAATGATCCGAGATGGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAGGTGTTGAGGACGATGATGATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10936
Forward primer (5'-3')
ACGAGAATGATCCGAGATGGGC
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 1300+580
Solanum pennellii LA716: 580+550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAAGGTGTTGAGGACGATGATGATG
Enzymes
All possible enzymes for pennellii and and lycopersicum: HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g02420  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7593 marker 7593
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)