SGN Marker TG365

SGN-M76

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAAAAGCGCAGCTTTGGGGCCACAATCGTAAGAAATCTTTCCAAGCGTTTAAGAAGCCAACCGCATCCTCCTCGGACAATTGATAGGAGT
TCAACAGCAGCTCAGAATGTTCTCAAAGGCTTCAAATTTATCAGTAGGACTGATGGTGGCTCTGGATGGGACACCGTCCAACAGCGATTC
GACGAGCTTACTGCCAACTCAGATAGCTTACTACCTAAAGCAAAATTTGGAGAATGCATAGGTAAAAGGATCCGAGTTTTAACTGACTGT
GTAAAAGTAATTTACATCATCAAGTTACCTAAAAACATGTAATTATGTAAATAATTTACACGTCGTATTTCACTGGATATGTTGTTGTTT
GTTGATTTTCAATGATAGGTATGAACAAGGAATCTGAGGGATTTGCATTAGAGCTTTTTGATGCGTTAGCTCGGAGGAGAAATATGACAA
GTGGTTGCA
Reverse sequence
ACTGGGAGTAAAATCAGTGCCATGTTTAGCTTAAGTACCTCGGCAGCCCCTTTCGCCACACAAACGCAATGACCCATGACATCAAATGCT
GCTTTGTTTCTGTACTGGACATATTTGTAACCAAATAGTCCAGCCATCACACTAATCCATAATAACAGTACCCAAACTCTTCGCCAATTG
TCTAACAAAAAGTACGTCAAATTGTTATACCATCTTTTAATGGGATTAGTCTCCAATGTTGGCTTAAGCTTCATGCTTAGCATATGACTT
AATTTCCTATGCAAGCCTTTTCCTCCATCTGATTGAATTGGAGCTTGTAATAAAAGCATTTTTAAGTTCTCAAGCTGTCAAATCGAATCA
GATGATAAATAGTTAAAACGATATTTATTTTCAAATTGAGATCATTGAACATGAAATAAAACTAGTCTAACCATGATGTATCCTTTGCGT
TCGCGATCCAACTCTTCCATGATCAAC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132216)
Chromosome
6
Position
97.32 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato QTL map   
Map version
137 (location: 53890)
Chromosome
6
Position
55.40 cM
Confidence
uncalculated
Protocol
RFLP

3_Methylthio_propanal_content_mta6_1 2_Isobutylthiazole_content_ibt6_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53546)
Chromosome
6
Position
48.28 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50378)
Chromosome
6
Position
51.49 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48312)
Chromosome
6
Position
54.03 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43863)
Chromosome
6
Position
58.40 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43606)
Chromosome
6
Position
49.30 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43325)
Chromosome
6
Position
60.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42448)
Chromosome
6
Position
79.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40866)
Chromosome
6
Position
56.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40014)
Chromosome
6
Position
50.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 7978)
Chromosome
6
Position
92.28 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Eggplant-LXM 2002   
Map version
29 (location: 7975)
Chromosome
6
Position
88.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7974)
Chromosome
6
Position
42.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7980)
Chromosome
6
Position
56.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG365 was used as an overgo probe on plate 2 [well H11]

Plausible BAC Matches:   P080N18,   P095G14,   P257H08,   P144A07,   P161O23,   P100J07,   P062F24,   P109C03,   P309D09,   P127B09,   P245G14,   P276I13,   P218K19,   P185J23,   P112L10

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCCTCCTCGGACAATTGATAGGAG
B sequence
CTGAGCTGCTGTTGAACTCCTATC
AB sequence
TCCTCCTCGGACAATTGATAGGAGTTCAAC
Marker sequence
AAAAAGCGCAGCTTTGGGGCCACAATCGTAAGAAATCTTTCCAAGCGTTT
AAGAAGCCAACCGCATCCTCCTCGGACAATTGATAGGAGTTCAACAGCAG
CTCAGAATGTTCTCAAAGGCTTCAAATTTATCAGTAGGACTGATGGTGGC
TCTGGATGGGACACCGTCCAACAGCGATTCGACGAGCTTACTGCCAACTC
AGATAGCTTACTACCTAAAGCAAAATTTGGAGAATGCATAGGTAAAAGGA
TCCGAGTTTTAACTGACTGTGTAAAAGTAATTTACATCATCAAGTTACCT
AAAAACATGTAATTATGTAAATAATTTACACGTCGTATTTCACTGGATAT
GTTGTTGTTTGTTGATTTTCAATGATAGGTATGAACAAGGAATCTGAGGG
ATTTGCATTAGAGCTTTTTGATGCGTTAGCTCGGAGGAGAAATATGACAA
GTGGTTGCA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG365  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D76 marker 76
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)