SGN Marker C2_At3g03100

SGN-M7602
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301532 (SGN)
123398 (CGN)
---
Capsicum annuumSingleSGN-U196979---
Lycopersicon CombinedSingleSGN-U216726---
Solanum tuberosumSingleSGN-U248811---
ArabidopsisSingleAt3g03100 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46653)
Chromosome
3
Position
51.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42209)
Chromosome
3
Position
74.80 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43775
Forward primer (5'-3')
TGTCTTAATCAGTTTGCCTTGTAGAT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41401)
Chromosome
3
Position
94.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43377
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38420)
Chromosome
3
Position
72.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39665
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
Accessions and product sizes
Solanum pennellii TA56
950
Solanum lycopersicum TA209
900
Approximate temperature
55°C
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
900
Solanum pennellii TA56
950
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26026)
Chromosome
3
Position
0.71 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10943
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 10944
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 10945
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 13119
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 13120
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 13121
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13122
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1031
Approximate temperature
55°C
  
PCR data   Exp. ID 13123
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1031
Approximate temperature
55°C
  
PCR data   Exp. ID 32985
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 10946
Forward primer (5'-3')
TGGTGCAACACTTGTTGGTGTGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 950
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGAGCCAGCCATGCCATTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AflII,HaeIII,HinfI,TspRI
  
Accessions and product sizes
Solanum pennellii LA716: 950
Solanum lycopersicum LA925: 900
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At3g03100F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At3g03100  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7602 marker 7602
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)