SGN Marker C2_At3g03440

SGN-M7604
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306516 (SGN)
126075 (CGN)
---
Capsicum annuumSingleSGN-U197768---
Lycopersicon CombinedMultipleSGN-U219454---
Solanum tuberosumSingleSGN-U250374---
ArabidopsisSingleAt3g03440 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26028)
Chromosome
3
Position
0.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41331
Forward primer (5'-3')
AGATCCGCCGTTTAACTAAGACTTC
Accessions and product sizes
Solanum pennellii TA56
1550
Solanum lycopersicum TA209
1550
Approximate temperature
55°C
Reverse primer (5'-3')
TTAGTGGCAGGAGAAGCAGATAATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 32327
Forward primer (5'-3')
AGATCCGCCGTTTAACTAAGACTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTGGCAGGAGAAGCAGATAATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32328
Forward primer (5'-3')
AGATCCGCCGTTTAACTAAGACTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTGGCAGGAGAAGCAGATAATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 32329
Forward primer (5'-3')
AGATCCGCCGTTTAACTAAGACTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTAGTGGCAGGAGAAGCAGATAATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1650
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g03440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7604 marker 7604
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)