SGN Marker C2_At3g04870

SGN-M7617
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U204156---
Lycopersicon CombinedSingleSGN-U216176---
Solanum tuberosumSingleSGN-U267276---
ArabidopsisSingleAt3g04870 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38427)
Chromosome
1
Position
101.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39672
Forward primer (5'-3')
ACGCGTGCTAGCATCCAGAGG
Accessions and product sizes
Solanum pennellii TA56
360
Solanum lycopersicum TA209
360
Approximate temperature
55°C
Reverse primer (5'-3')
TGACATGGCAAGCCCACTAACATAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26042)
Chromosome
3
Position
1.35 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10963
Forward primer (5'-3')
ACGCGTGCTAGCATCCAGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACATGGCAAGCCCACTAACATAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 10964
Forward primer (5'-3')
ACGCGTGCTAGCATCCAGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACATGGCAAGCCCACTAACATAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 10965
Forward primer (5'-3')
ACGCGTGCTAGCATCCAGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACATGGCAAGCCCACTAACATAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 32340
Forward primer (5'-3')
ACGCGTGCTAGCATCCAGAGG
Digested band sizes (using BsaHI)
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACATGGCAAGCCCACTAACATAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: BsaHI
All possible enzymes for lycopersicum and pimpinellifolium: BsaHI
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g04870F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At3g04870F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g04870  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7617 marker 7617
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)