SGN Marker C2_At3g05070

SGN-M7622
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309749 (SGN)
132036 (CGN)
---
Capsicum annuumSingleSGN-U205136---
Lycopersicon CombinedSingleSGN-U230297---
Solanum tuberosumSingleSGN-U255751---
ArabidopsisSingleAt3g05070 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26047)
Chromosome
3
Position
1.42 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41339
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
Accessions and product sizes
Solanum lycopersicum TA209
300
Solanum pennellii TA56
400+450+1000
Approximate temperature
55°C
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 10966
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400+450+1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10967
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10968
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13134
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13135
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13136
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13137
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13138
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13139
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13140
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13141
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 310
Approximate temperature
55°C
  
PCR data   Exp. ID 13142
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13143
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13144
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13145
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 310
Approximate temperature
55°C
  
PCR data   Exp. ID 13146
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32990
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 310
Approximate temperature
55°C
  
PCR data   Exp. ID 32991
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32992
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32993
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 32994
Forward primer (5'-3')
ACCTGCCACATGACAAGCAGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCAAGTTTCTTTTGCACATCCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Forward amplicon sequence for Physalis spp. TA1367, plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Forward amplicon sequence for C. canephora BP409, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Reverse amplicon sequence for Physalis spp. TA1367, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Reverse amplicon sequence for C. canephora BP409, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Forward amplicon sequence for Physalis spp. TA1367, plain text
Forward amplicon sequence for , AB1 chromatogram - [View]
Forward amplicon sequence for , plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Forward amplicon sequence for S. melongena TA2986, plain text
Forward amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Forward amplicon sequence for N. tomentosiformis TA3349, plain text
Forward amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Forward amplicon sequence for C. canephora BP409, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for Physalis spp. TA1367, AB1 chromatogram - [View]
Reverse amplicon sequence for Physalis spp. TA1367, plain text
Reverse amplicon sequence for , AB1 chromatogram - [View]
Reverse amplicon sequence for , plain text
Reverse amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Reverse amplicon sequence for S. lycopersicum TA209, plain text
Reverse amplicon sequence for S. melongena TA2986, AB1 chromatogram - [View]
Reverse amplicon sequence for S. melongena TA2986, plain text
Reverse amplicon sequence for N. tomentosiformis TA3349, AB1 chromatogram - [View]
Reverse amplicon sequence for N. tomentosiformis TA3349, plain text
Reverse amplicon sequence for C. canephora BP409, AB1 chromatogram - [View]
Reverse amplicon sequence for C. canephora BP409, plain text

Genomic location of C2_At3g05070  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7622 marker 7622
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)