SGN Marker C2_At3g06440

SGN-M7637
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302082 (SGN)
120059 (CGN)
---
Solanum tuberosumSingleSGN-U266611---
ArabidopsisSingleAt3g06440 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41402)
Chromosome
5
Position
76.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43378
Forward primer (5'-3')
TCGTTAGGATTGATGAAGTTCTATCTAGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GATTCACAACCGGCATTGTAAAATCT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38432)
Chromosome
5
Position
98.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39676
Forward primer (5'-3')
TCGTTAGGATTGATGAAGTTCTATCTAGC
Accessions and product sizes
Solanum lycopersicum TA209
1100
Solanum pennellii TA56
1100
Approximate temperature
55°C
Reverse primer (5'-3')
ATAATATAACCTGGTCCATGTGCCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26062)
Chromosome
3
Position
1.97 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10973
Forward primer (5'-3')
TCGTTAGGATTGATGAAGTTCTATCTAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATAATATAACCTGGTCCATGTGCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250+350
Approximate temperature
55°C
  
PCR data   Exp. ID 10974
Forward primer (5'-3')
TCGTTAGGATTGATGAAGTTCTATCTAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATAATATAACCTGGTCCATGTGCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250+350
Approximate temperature
55°C
  
PCR data   Exp. ID 10975
Forward primer (5'-3')
TCGTTAGGATTGATGAAGTTCTATCTAGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATAATATAACCTGGTCCATGTGCCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250+350
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g06440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7637 marker 7637
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)