SGN Marker C2_At3g06730

SGN-M7640
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311903 (SGN)
126724 (CGN)
---
Lycopersicon CombinedSingleSGN-U218486---
ArabidopsisSingleAt3g06730 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41403)
Chromosome
1
Position
191.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43379
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38435)
Chromosome
1
Position
92.80 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39679
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
170
Solanum lycopersicum TA209
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26066)
Chromosome
3
Position
2.13 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10983
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10984
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 10985
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13168
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13169
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13170
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 380
Approximate temperature
55°C
  
PCR data   Exp. ID 32629
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 33002
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 33003
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 10986
Forward primer (5'-3')
ACAGATGATGAATACGAATTTGC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 170
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCATTTGTATCGGGATGAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g06730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7640 marker 7640
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)