SGN Marker C2_At3g06790

SGN-M7642
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307942 (SGN)
125980 (CGN)
---
Capsicum annuumSingleSGN-U199747---
Solanum tuberosumSingleSGN-U248774---
ArabidopsisSingleAt3g06790 on TAIR---
Mapped locations  
Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47172)
Chromosome
1
Position
34.35 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46655)
Chromosome
9
Position
36.00 cM
Confidence
CF(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46477)
Chromosome
9
Position
15.10 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41404)
Chromosome
1
Position
117.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43380
Forward primer (5'-3')
ATACACTGGGTTTGGTGTTTTGATTTC
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TCCTTGTTGGGGACATCTAGATATGAATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38436)
Chromosome
1
Position
31.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39680
Forward primer (5'-3')
ATACACTGGGTTTGGTGTTTTGATTTC
Accessions and product sizes
Solanum lycopersicum TA209
1200
Solanum pennellii TA56
1200
Approximate temperature
58°C
Reverse primer (5'-3')
TCCTTGTTGGGGACATCTAGATATGAATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
950
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26068)
Chromosome
3
Position
2.14 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10987
Forward primer (5'-3')
ATTGCTGCCGTTGTCGGAAGTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCAAAACACCAAACCCAGTGTATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450+950
Approximate temperature
Unknown
  
PCR data   Exp. ID 10988
Forward primer (5'-3')
ATTGCTGCCGTTGTCGGAAGTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCAAAACACCAAACCCAGTGTATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
Unknown
  
PCR data   Exp. ID 10989
Forward primer (5'-3')
ATTGCTGCCGTTGTCGGAAGTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCAAAACACCAAACCCAGTGTATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
Unknown
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g06790  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7642 marker 7642
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)