SGN Marker C2_At3g08030

SGN-M7661
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple304936 (SGN)
123789 (CGN)
---
Capsicum annuumSingleSGN-U196708---
Solanum tuberosumSingleSGN-U246034---
ArabidopsisSingleAt3g08030 on TAIR---
Mapped locations  
Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47173)
Chromosome
1
Position
52.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46656)
Chromosome
1
Position
56.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46478)
Chromosome
1
Position
64.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38440)
Chromosome
1
Position
47.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39683
Forward primer (5'-3')
AGGCTTCAATTTCTCAGACAATTCC
Accessions and product sizes
Solanum pennellii TA56
1650
Solanum lycopersicum TA209
1650
Approximate temperature
55°C
Reverse primer (5'-3')
TTCAAAACCAGCATTTTTAACCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26087)
Chromosome
3
Position
2.57 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32354
Forward primer (5'-3')
AGGCTTCAATTTCTCAGACAATTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCAAAACCAGCATTTTTAACCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32355
Forward primer (5'-3')
AGGCTTCAATTTCTCAGACAATTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCAAAACCAGCATTTTTAACCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32356
Forward primer (5'-3')
AGGCTTCAATTTCTCAGACAATTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCAAAACCAGCATTTTTAACCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 32357
Forward primer (5'-3')
AGGCTTCAATTTCTCAGACAATTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCAAAACCAGCATTTTTAACCAAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: HincII
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g08030  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7661 marker 7661
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)