SGN Marker C2_At3g08760

SGN-M7666
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308096 (SGN)
131977 (CGN)
---
Capsicum annuumMultipleSGN-U199380---
Lycopersicon CombinedMultipleSGN-U220505---
Solanum tuberosumSingleSGN-U268015---
ArabidopsisSingleAt3g08760 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49239)
Chromosome
10
Position
58.06 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47174)
Chromosome
10
Position
28.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46657)
Chromosome
10
Position
42.90 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42211)
Chromosome
10
Position
85.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43777
Forward primer (5'-3')
TCTCCAGAACGTTGTGTGTCAGAAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTCATGTAGAAATGTAAGACCTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41405)
Chromosome
10
Position
58.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43381
Forward primer (5'-3')
TCTCCAGAACGTTGTGTGTCAGAAGG
Accessions and product sizes
Approximate temperature
64°C
Reverse primer (5'-3')
TCCTCATGTAGAAATGTAAGACCTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38442)
Chromosome
10
Position
39.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39684
Forward primer (5'-3')
TCTCCAGAACGTTGTGTGTCAGAAGG
Accessions and product sizes
Solanum pennellii TA56
Multiple
Approximate temperature
50°C
Reverse primer (5'-3')
TCCTCATGTAGAAATGTAAGACCTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26092)
Chromosome
3
Position
2.66 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32358
Forward primer (5'-3')
TCTCCAGAACGTTGTGTGTCAGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTCATGTAGAAATGTAAGACCTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700+750
Approximate temperature
55°C
  
PCR data   Exp. ID 32359
Forward primer (5'-3')
TCTCCAGAACGTTGTGTGTCAGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTCATGTAGAAATGTAAGACCTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700+750
Approximate temperature
55°C
  
PCR data   Exp. ID 32360
Forward primer (5'-3')
TCTCCAGAACGTTGTGTGTCAGAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTCATGTAGAAATGTAAGACCTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 700+750
Approximate temperature
55°C
  
PCR data   Exp. ID 32361
Forward primer (5'-3')
TCTCCAGAACGTTGTGTGTCAGAAGG
Digested band sizes (using AluI)
Solanum pennellii LA716: 300+425+475
Solanum lycopersicum LA925: 600525
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTCATGTAGAAATGTAAGACCTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700+750
Solanum pennellii LA716: 700+750
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g08760  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7666 marker 7666
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)