SGN Marker C2_At3g08950

SGN-M7668
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304577 (SGN)
125005 (CGN)
---
Lycopersicon CombinedSingleSGN-U240958---
Solanum tuberosumSingleSGN-U251358---
ArabidopsisSingleAt3g08950 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26094)
Chromosome
3
Position
2.73 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41353
Forward primer (5'-3')
ACCAGTAACTGAGAAAGACTTCTTTGG
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
ACTTGCTCAACCGTATCTCTTTCAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
390+650
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 32362
Forward primer (5'-3')
ACCAGTAACTGAGAAAGACTTCTTTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACTTGCTCAACCGTATCTCTTTCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550+850
Approximate temperature
53°C
  
PCR data   Exp. ID 32363
Forward primer (5'-3')
ACCAGTAACTGAGAAAGACTTCTTTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACTTGCTCAACCGTATCTCTTTCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550+1400
Approximate temperature
53°C
  
PCR data   Exp. ID 32364
Forward primer (5'-3')
ACCAGTAACTGAGAAAGACTTCTTTGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
ACTTGCTCAACCGTATCTCTTTCAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 550+1400
Approximate temperature
53°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g08950  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7668 marker 7668
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)