SGN Marker SSR94

SGN-M767

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 45
Repeat motif: AT   Repeat number: 11
Repeat motif:    Repeat number:
Forward primer: AATCAGATCCTTGCCCTTGA
Reverse primer: AGCTGAGAAAGAGCAGCCAT
Predicted size: 187
Derivations 
This marker was derived from EST read SGN-E109993
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39304)
Chromosome
4
Position
60.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31686
Forward primer (5'-3')
AATCAGATCCTTGCCCTTGA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGCTGAGAAAGAGCAGCCAT
Enzymes
  
Accessions and product sizes
Approximate temperature
45°C
  
Overgo hybridization and physical mapping 
SSR94 was used as an overgo probe on plate 7 [well H1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGCTGCTCTTTCTCAGCTCTTAG
B sequence
ATGGTGTAGATATGAGCTAAGAGC
AB sequence
TGGCTGCTCTTTCTCAGCTCTTAGCTCATA
Marker sequence
ATATAGATATTCAATTCAACAAATATATAGATGCACAATTCAATTCTCTC
CACTCTCTGTCCTTTAATTTCTCGCTCGCTCCTCTCACGATTTCTCTCTC
TTATCTCTAACACGTAACTATGAATCGTAATTAGCAAATCACAAGTATAG
GATCTAATTAAGTTATTTTTAAAAGCCGTTTGGGAAAGGCAATTATTTTT
ATGACCAATCAGATCCTTGCCCTTGAAATGTCTTCATATATAGATATATA
TATATATATATATATTAGAGTAAAAGCAAATTGCACCCGGGTGCAAACCT
AAATGTACCAAAAAAGAAGAAACTTCTCTTTCTTTGTATACACATCATAA
TCATATATACAATAACAACAATTATGGCTGCTCTTTCTCAGCTCTTAGCT
CATATCTACACCATGACTCTAGTCTTCGTCACCATTCTCATACTCGAACT
CGTAATCTTAGTACGTTCCATAACCGACACAATCTCAGATTCCGGCCGCG
GCCGCCCCATCACAACCAAGCAATACCTCAAACTCATCGACGAAAAAAAC
CCGGTCAGCCGGTTCAAAACCCCCTCAATCAACCCGGCCGGTTTTTCCGA
TACCTGTGCCGTTTGTTTATCGGCATTTGAAGACGGCGAACAA
Genomic location of SSR94  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D767 marker 767
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)