SGN Marker C2_At3g09920

SGN-M7679
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple309249 (SGN)
126841 (CGN)
---
Capsicum annuumSingleSGN-U202005---
Lycopersicon CombinedMultipleSGN-U215749---
Solanum tuberosumSingleSGN-U250947---
ArabidopsisSingleAt3g09920 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46658)
Chromosome
7
Position
83.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46479)
Chromosome
7
Position
81.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42212)
Chromosome
9
Position
11.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43778
Forward primer (5'-3')
AAGCAATCATAAAGGGTCACAGGAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGACCATTGGGCAATAATCTTTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41406)
Chromosome
9
Position
7.50 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43382
Forward primer (5'-3')
CATTCTTGAAGGCAGGCAATCATTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGACCATTGGGCAATAATCTTTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38445)
Chromosome
9
Position
17.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39686
Forward primer (5'-3')
AAGCAATCATAAAGGGTCACAGGAG
Accessions and product sizes
Solanum pennellii TA56
450
Solanum lycopersicum TA209
450
Approximate temperature
55°C
Reverse primer (5'-3')
AGACCATTGGGCAATAATCTTTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26105)
Chromosome
3
Position
3.04 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32371
Forward primer (5'-3')
AAGCAATCATAAAGGGTCACAGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACCATTGGGCAATAATCTTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32372
Forward primer (5'-3')
AAGCAATCATAAAGGGTCACAGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACCATTGGGCAATAATCTTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32373
Forward primer (5'-3')
AAGCAATCATAAAGGGTCACAGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACCATTGGGCAATAATCTTTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 32374
Forward primer (5'-3')
AAGCAATCATAAAGGGTCACAGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGACCATTGGGCAATAATCTTTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g09920  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7679 marker 7679
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)