SGN Marker C2_At3g09925

SGN-M7680
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Lycopersicon CombinedSingleSGN-U224018---
Solanum tuberosumSingleSGN-U249764---
ArabidopsisSingleAt3g09925 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132185)
Chromosome
9
Position
12.86 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Pepper-COSII   
Map version
58 (location: 41407)
Chromosome
9
Position
13.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43383
Forward primer (5'-3')
ATTGAAGCCTCAGATGGAATGGATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACATGGGAGTTGTGTAGTAGAAAGGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38446)
Chromosome
9
Position
25.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39687
Forward primer (5'-3')
ATTGAAGCCTCAGATGGAATGGATG
Accessions and product sizes
Solanum lycopersicum TA209
920
Solanum pennellii TA56
920
Approximate temperature
55°C
Reverse primer (5'-3')
ACATGGGAGTTGTGTAGTAGAAAGGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26106)
Chromosome
3
Position
3.05 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10997
Forward primer (5'-3')
ATTGAAGCCTCAGATGGAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATGGGAGTTGTGTAGTAGAAAGGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10998
Forward primer (5'-3')
ATTGAAGCCTCAGATGGAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATGGGAGTTGTGTAGTAGAAAGGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 880
Approximate temperature
55°C
  
PCR data   Exp. ID 10999
Forward primer (5'-3')
ATTGAAGCCTCAGATGGAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATGGGAGTTGTGTAGTAGAAAGGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 880
Approximate temperature
55°C
  
PCR data   Exp. ID 11000
Forward primer (5'-3')
ATTGAAGCCTCAGATGGAATGGATG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 880
Solanum pennellii LA716: 1000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATGGGAGTTGTGTAGTAGAAAGGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 880
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g09925  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7680 marker 7680
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)