SGN Marker C2_At3g10140

SGN-M7685
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307395 (SGN)
126945 (CGN)
---
Capsicum annuumSingleSGN-U199499---
Lycopersicon CombinedSingleSGN-U236649---
Solanum tuberosumSingleSGN-U257312---
ArabidopsisSingleAt3g10140 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38448)
Chromosome
10
Position
52.80 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39689
Forward primer (5'-3')
TTGAGCTTGATGCTACGTTATGTGAC
Accessions and product sizes
Solanum lycopersicum TA209
550
Solanum pennellii TA56
550
Approximate temperature
55°C
Reverse primer (5'-3')
TAACTTCATGTTCACAAGCCAATTCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
450
Solanum lycopersicum TA209
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26111)
Chromosome
3
Position
3.14 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At3g10140  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7685 marker 7685
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)