Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker C2_At3g10220

SGN-M7686
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306863 (SGN)
128479 (CGN)
---
Lycopersicon CombinedSingleSGN-U223049---
Solanum tuberosumSingleSGN-U246159---
ArabidopsisSingleAt3g10220 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38449)
Chromosome
3
Position
76.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39690
Forward primer (5'-3')
TGGCTTCTCAGTTACAGATTCAAGG
Accessions and product sizes
Solanum pennellii TA56
425
Solanum lycopersicum TA209
425
Approximate temperature
55°C
Reverse primer (5'-3')
AACCTCCGGAGGTCACTGACG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
350
Solanum pennellii TA56
425
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26112)
Chromosome
3
Position
3.16 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32379
Forward primer (5'-3')
TGGCTTCTCAGTTACAGATTCAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACCTCCGGAGGTCACTGACG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32380
Forward primer (5'-3')
TGGCTTCTCAGTTACAGATTCAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACCTCCGGAGGTCACTGACG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32381
Forward primer (5'-3')
TGGCTTCTCAGTTACAGATTCAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACCTCCGGAGGTCACTGACG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32382
Forward primer (5'-3')
TGGCTTCTCAGTTACAGATTCAAGG
Digested band sizes (using HinfI)
Solanum pennellii LA716: 100+300+700
Solanum lycopersicum LA925: 200+800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACCTCCGGAGGTCACTGACG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g10220  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7686 marker 7686
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)