SGN Marker C2_At3g11210

SGN-M7698
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304225 (SGN)
120576 (CGN)
---
Lycopersicon CombinedSingleSGN-U216577---
Solanum tuberosumSingleSGN-U257742---
ArabidopsisSingleAt3g11210 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42213)
Chromosome
6
Position
38.30 cM
Confidence
I
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43779
Forward primer (5'-3')
CTCTACAAAATTGAGAACATCTGCGAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATTCTGTTGCCATTGATTTCCAGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41409)
Chromosome
1
Position
157.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43385
Forward primer (5'-3')
AGGCCTGTATAGAGCTATGCAAAGAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATTCTGTTGCCATTGATTTCCAGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38451)
Chromosome
6
Position
24.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39692
Forward primer (5'-3')
AGGCCTGTATAGAGCTATGCAAAGAG
Accessions and product sizes
Solanum pennellii TA56
250
Solanum lycopersicum TA209
250
Approximate temperature
55°C
Reverse primer (5'-3')
AATTCTGTTGCCATTGATTTCCAGTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
100+150
Solanum pennellii TA56
250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26125)
Chromosome
3
Position
3.51 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32383
Forward primer (5'-3')
AGGCCTGTATAGAGCTATGCAAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTCTGTTGCCATTGATTTCCAGTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32384
Forward primer (5'-3')
AGGCCTGTATAGAGCTATGCAAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTCTGTTGCCATTGATTTCCAGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32385
Forward primer (5'-3')
AGGCCTGTATAGAGCTATGCAAAGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTCTGTTGCCATTGATTTCCAGTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32386
Forward primer (5'-3')
AGGCCTGTATAGAGCTATGCAAAGAG
Digested band sizes (using HinfI)
Solanum pennellii LA716: 220+500
Solanum lycopersicum LA925: 250+350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATTCTGTTGCCATTGATTTCCAGTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI,BstBI,EcoRV,HinfI,Hpy188I
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At3g11210  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7698 marker 7698
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)