SGN Marker C2_At3g11830

SGN-M7704
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310363 (SGN)
131923 (CGN)
---
Capsicum annuumSingleSGN-U197417---
Lycopersicon CombinedSingleSGN-U227413---
Solanum tuberosumMultipleSGN-U245085---
ArabidopsisSingleAt3g11830 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26131)
Chromosome
3
Position
3.73 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41365
Forward primer (5'-3')
TGAGCAACATAAATGCATGTATGGC
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
AGAACAACTGTAGTGGTTCCATCACC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
220
Solanum pennellii TA56
320
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 11020
Forward primer (5'-3')
TGAGCAACATAAATGCATGTATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACAACTGTAGTGGTTCCATCACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 11021
Forward primer (5'-3')
TGAGCAACATAAATGCATGTATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACAACTGTAGTGGTTCCATCACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 430
Approximate temperature
55°C
  
PCR data   Exp. ID 11022
Forward primer (5'-3')
TGAGCAACATAAATGCATGTATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACAACTGTAGTGGTTCCATCACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 430
Approximate temperature
55°C
  
PCR data   Exp. ID 11023
Forward primer (5'-3')
TGAGCAACATAAATGCATGTATGGC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 430
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAACAACTGTAGTGGTTCCATCACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: BclI,HinfI,PflMI
All possible enzymes for lycopersicum and pimpinellifolium: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 430
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At3g11830F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At3g11830  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7704 marker 7704
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)