Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker SSR98

SGN-M771

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 60 High: 40.909
Repeat motif: TCT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: CAACCCATCAATAATAACACCC
Reverse primer: CCACTGCAGTAGGTAGCTGG
Predicted size: 130
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39306)
Chromosome
1
Position
32.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14077
Forward primer (5'-3')
CAACCCATCAATAATAACACCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCACTGCAGTAGGTAGCTGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 130+129
Solanum pimpinellifolium LA1589: 130+120
Approximate temperature
50°C
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of SSR98  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D771 marker 771
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)