SGN Marker SSR99

SGN-M772

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40.909 High: 42.857
Repeat motif: AG   Repeat number: 6
Repeat motif: AT   Repeat number: 5
Repeat motif:    Repeat number:
Forward primer: GCCTCGGATTCAATAGCATTA
Reverse primer: CACAAAGAAGCAAACAACTCCA
Predicted size: 176
Derivations 
This marker was derived from EST read SGN-E103626
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39307)
Chromosome
9
Position
50.35 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31729
Forward primer (5'-3')
GCCTCGGATTCAATAGCATTA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CACAAAGAAGCAAACAACTCCA
Enzymes
  
Accessions and product sizes
Approximate temperature
42°C
  
Overgo hybridization and physical mapping 
SSR99 was used as an overgo probe on plate 7 [well A1]

Plausible BAC Matches:   P147M03

 Overgo Sequences

A sequence
CGCTATGGACGTTACAAAGAGATC
B sequence
TTGCTCCTTTCCCAAGGATCTCTT
AB sequence
CGCTATGGACGTTACAAAGAGATCCTTGGG
Marker sequence
AGCCTCGGATTCAATAGCATTAGCTTATCTATTATCTTTTTAATTACATC
AAGAGAAACTACATTAGTTTTGTGTTTTTGTTCTAATAAAGTTTAGTGAT
AATCATATATATATAGAGAGAGAGAGAAAGTAGTTGCTTGTTAAATATAT
TTTGTTGGAGTTGTTTGCTTCTTTGTGTATGTATAAGGATTTGGTTGAAC
ATGCTTAAAGTTGGGATGAATGAAATGCTTGATGTTAATGGAACAAATTT
GGAGTTGGAGTATGTGGAAGTGGATTCATCTAAACGCTATGGACGTTACA
AAGAGATCCTTGGGAAAGGAGCAACCAAGATAGTATACAGAGCATTTGAT
GAGTTACTAGGAATGGAAGTAGCTTGGAACCAAGTGAAACTCAATGACAT
GTTTAGGTCACCTGAAGAATTACAAAGGCTCTACTCAGAAGTCCATCTCC
TCAAAGAACTTGATCATGAAGCCATCATGAAATTCCATGCATCTTGGATC
AATGTTGAAAGCAGAACCTTCAACTTCATTACTGAAA
Genomic location of SSR99  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D772 marker 772
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)