SGN Marker C2_At3g13180

SGN-M7726
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302633 (SGN)
124538 (CGN)
---
Lycopersicon CombinedSingleSGN-U237594---
Solanum tuberosumMultipleSGN-U249616---
ArabidopsisSingleAt3g13180 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49242)
Chromosome
12
Position
5.69 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47177)
Chromosome
12
Position
56.42 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46660)
Chromosome
6
Position
25.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41411)
Chromosome
3
Position
61.40 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43387
Forward primer (5'-3')
TATTGTTGATCCACAGCCTGGTGAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGGGAATATGGTGCTTGTATTGAAGG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38460)
Chromosome
12
Position
55.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39700
Forward primer (5'-3')
TATTGTTGATCCACAGCCTGGTGAG
Accessions and product sizes
Solanum lycopersicum TA209
1400
Solanum pennellii TA56
1400
Approximate temperature
55°C
Reverse primer (5'-3')
TCCGCAATCGACCTTCATTTATGTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1350
Solanum lycopersicum TA209
1400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26153)
Chromosome
3
Position
4.24 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g13180  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7726 marker 7726
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)