SGN Marker C2_At3g14240

SGN-M7737
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300549 (SGN)
121805 (CGN)
---
Lycopersicon CombinedSingleSGN-U225323---
ArabidopsisSingleAt3g14240 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26165)
Chromosome
3
Position
4.74 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41382
Forward primer (5'-3')
ATGGATGAATCAACTGGAAATTCG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGGACTTGTCACTTCATGCTTCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At3g14240  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7737 marker 7737
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)