SGN Marker C2_At3g14910

SGN-M7740
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301769 (SGN)
121213 (CGN)
---
Capsicum annuumSingleSGN-U198827---
Lycopersicon CombinedSingleSGN-U223694---
ArabidopsisSingleAt3g14910 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46665)
Chromosome
7
Position
12.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41415)
Chromosome
7
Position
108.40 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43391
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38467)
Chromosome
7
Position
61.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39707
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
Accessions and product sizes
Solanum lycopersicum TA209
200
Solanum pennellii TA56
200
Approximate temperature
53°C
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26168)
Chromosome
3
Position
5.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11048
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11049
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11050
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13198
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13199
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13200
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 700+1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13201
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13202
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13203
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13204
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13205
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13206
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13207
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13208
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13209
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13210
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33017
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33018
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33019
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33020
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11051
Forward primer (5'-3')
TCTCCGTGGTGATCTGATTCATAAAC
Digested band sizes (using AluI)
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AATCTAAGAATCTTTCCAGGGCTTAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g14910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7740 marker 7740
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)